Skip to main content

Advanced Genomics Profiling Services

Sample Submission

To request an AGP service through Infinity, please follow the Infinity instructions. All requests must be supported by a current investigator's IBC number.

If you are already registered with Infinity, you can use your existing user information, request the preferred service, review, and approve the quote upon receipt.

If you don't have an existing account with Infinity, you can register as an internal user or as an external user. Complete the requested information. Infinity support staff will create your account. Do not sign up if you’ve already received an Infinity welcome email. You will receive an Infinity welcome email once your account has been created. This will contain your login and password.

Send samples to the following address:

Advanced Genomics Profiling Shared Resource
Hollings Cancer Center
Medical University of South Carolina
68 President Street, BE426
Charleston, SC 29425

Samples will only be processed after an AGP-submitted quote has been approved by the user.

Note: The core has the right to not accept samples if they do not pass QC.

All samples (DNA and RNA) and libraries will be discarded after 1 month of data delivery. Please be mindful of the time and pick up your samples. After this time, AGP will not be responsible for sample storage.

Automated Purification of Nucleic Acids

Pricing | Sample Submission

AGP uses the Maxwell® RSC from Promega, which offers a highly reliable, automated solution for extracting high-quality DNA and RNA from a wide diversity of sample inputs. The system processes up to 16 samples simultaneously using prefilled reagent cartridges and preprogrammed protocols, ensuring consistent and reproducible yields across mixed sample types and variable input qualities.

Researchers can bring a spectrum of inputs—including whole blood, cultured cells, tissue, buffy coat & bone marrow, serum and plasma, stabilized saliva, FFPE sections, OCT fixed tissue, and food-based or environmental matrices. It can also purify genomic DNA and ccfDNA from Human Serum. Extractions are eluted in 30–100 μL, suitable for downstream applications such as NGS, Sanger sequencing, qPCR/dPCR, transcriptomics, biomarker discovery, and metagenomic workflows. 

DNA Isolation

Sample Type Submission Requirement
Cells >50K and <1X106 
Tissue >5mg and <50mg 
FFPE 5–10µm thick with a size range of 20mm2-200mm2 for a total of up to 2.0mm3 of tissue
(Only scrolls)

Blood 50–500µl of whole blood
Serum/Plasma 100–500μl
Buffy coat & bone marrow Up to 100μl of buffy coat

RNA Isolation

Sample Type Submission Requirement
Cells >500K and <5X106
Tissue >5mg and <20mg
FFPE 4X20um or 8X 10um
(Only scrolls)
Blood 2.5ml of fresh whole blood
Serum/Plasma 100–500μl
Buffy coat & bone marrow Up to 100μl of buffy coat

Please contact AGP for details on sample submission guidelines if they are not listed above.


Library generation and sequencing (bulk)

Pricing | Sample Submission

Bulk NGS (Next Generation Sequencing) refers to sequencing approaches where nucleic acids—usually DNA or RNA—are extracted from a mixed population of many cells, pooled together, and sequenced as a single combined sample. Unlike single-cell sequencing, which captures cell-by-cell information, bulk NGS measures the average genetic or transcriptomic signal across the entire sample, providing a population-level view of gene expression, variation, or molecular content.

In bulk RNA-seq specifically, researchers extract RNA from tissues or cell mixtures, convert it to cDNA, build sequencing libraries, and perform high-throughput NGS to quantify transcript levels across the whole sample. Because this method sequences millions of fragments in parallel using modern high-throughput NGS platforms, it enables comprehensive profiling of gene expression or genomic features with high speed, depth, and sensitivity across a large, pooled sample rather than individual cells.

Learn more about bulk and single-cell sequencing.

Service Type Sample Type Submission Requirement
(min amount)
Data Depth (M reads/sample)
ChIP-seq
DNA 10ng (1 ng/µL) and fragmented to 100-300bp 
20-30
mRNAseq
Total RNA Total RNA, 1 µg (25 ng/µL) RIN>7.0
15-25
Total RNA-seq
Total RNA 1 ug (Min:200 ng) (25ng/ul) Recommend: RIN>7 | Required: RIN>2.3
30-35
sRNA-seq (miRNA)
Total RNA 1 µg (100 ng/µL) RIN>7.0
10-15
ATACseq
Single cell suspension
Single cell suspension in 1X PBS (100,000-200,000), viability: 80%
30-40
Ultra-low input mRNA Seq 
Total RNA 10 ng (min:7 ng) (1 ng/ul) Recommend: RIN>8; Required: RIN>7 10-15
Ultra-low input mRNA Seq Live Cells 1000-100 cells 100 cells Cell viability: >85%  10-15
Ultra-low input Total RNA Seq
Total RNA 10 ng (Min:5 ng) (1 ng/ul)
Must be treated by RNase-free DNase
RIN>8
15-20
Whole Exome Sequencing
Genomic DNA 1 µg (10 ng) (1 ng/µl), DIN>7.0
OD260/OD230 Ratio around 2
50
Whole Genome Sequencing (WGS)
Genomic DNA 1 µg (10 ng) (1 ng/µl) DIN>7.0
OD260/OD230 Ratio around 2
300

Single-Cell Sequencing

Pricing | Sample Submission

Single-cell RNA sequencing (scRNA-seq) is a high-resolution method for profiling the whole transcriptome of individual cells, allowing researchers to examine the unique gene expression signatures of each cell within a complex tissue or mixed population. In contrast to bulk RNA-seq — which provides an averaged expression readout across thousands or millions of pooled cells — scRNA-seq resolves the cellular heterogeneity that is otherwise hidden in population-level measurements.

ScRNA-seq measurements come from individual cells, as opposed to a pool of cells. First, you need to generate viable single-cell suspensions from whole samples that have been digested through an enzymatic or mechanical process, cell sorting, or other cell isolation techniques. This is followed by cell counting and quality control steps to ensure samples have an appropriate concentration of viable cells and are free of clumps and cell debris.

If desired, you can also stain your sample with antibodies to label proteins and other biological analytes or perform FACS enrichment for cell types of interest.

Several of the above assays are available with both single and multiplex options.

Service Type Sample Type Requirement (min amount/sample)
Optimal conc. Cells/ul
Cell Viability
ScRNAseq (3’-kit)
Single cell >75,000
800-2000
>80%
SnRNAseq (3’-kit)
Single nuclei
>75,000
800-2000
<5%
scRNAseq with feature barcode
Single cell
>75,000
800-2000
>80%
scRNAseq Immune (5’-kit, TCR, BCR)
Single cell
>75,000 
800-2000
>80%
On-chip multiplexing (OCM) sc/snRNAseq (10x 3’ or 5’)
Single cell/nuclei
>50000
800-2000
>80% (cell)
<5% (nuclei)
Flex scRNAseq
Fixed single cell/nuclei
>500,000
- Intact membrane 
Epi ATACseq
Single nuclei
>75,000
3000-8000
Intact membrane
Epi Multiome ATAC GEM-X
Single nuclei >75,000 3000-8000 Intact membrane

Spatial Transcriptomics

Xenium In Situ Assay (Spatial Transcriptomics)

Pricing | Sample Submission

The Xenium™ In Situ platform enables high-resolution spatial transcriptomics by combining single-cell imaging with multiplexed RNA detection directly within intact tissue sections. This technology preserves tissue architecture while providing transcript-level information at subcellular resolution, allowing researchers to investigate cellular heterogeneity, tissue organization, and molecular interactions within their native biological context.

AGP offers Xenium-based spatial profiling services for both FFPE and fresh frozen tissues, supporting translational and biomarker discovery studies across oncology, immunology, neuroscience, and other disease areas.

Using highly sensitive probe chemistry and advanced imaging workflows, researchers can profile up to 5,000 genes while maintaining spatial localization of transcripts within tissue sections.

Key Features

  • High-plex RNA profiling with panels containing up to 5,000 genes.
  • Support for both FFPE and fresh frozen tissue specimens.
  • Single-cell and subcellular spatial resolution.
  • Customizable gene panels to address specific research questions.
  • Large imageable tissue area for comprehensive tissue coverage.
  • Non-destructive workflow allowing downstream histological evaluation.
  • Integrated image processing, cell segmentation, and transcript assignment.
  • Compatible with biomarker discovery, translational research, and precision medicine applications.

Recommended Sample Types

  • FFPE tissue sections.
  • Fresh frozen tissue sections.

Submission Guidelines

  • Tissue sections should be prepared according to Xenium specifications.
  • Adequate tissue integrity and morphology should be confirmed before submission. RNA quality check is strongly recommended (DV200>30%). Tissue quality check is recommended by H&E and DAPI staining.
  • Adjacent sections for H&E and DAPI staining are also recommended.
  • Sample quality assessment may be required before project initiation.

For consultation regarding tissue preparation, project design, or panel selection, please contact majumder@musc.edu.

User Responsibilities & Costs

Please note that the following items are not included in AGP service fees and must be provided or arranged by the research group:

  • 10x Genomics Xenium Reagent Kits: Purchased directly from 10x Genomics by the investigator/lab.
  • 10x Genomics Xenium Slides: Users must provide official Xenium slides compatible with the selected assay.
  • Tissue Sectioning & Slide Preparation: Users are responsible for providing tissue sections mounted on Xenium slides according to 10x Genomics specifications. AGP does not perform tissue sectioning or slide preparation. AGP accepts prepared tissue sections on slides that meet the Xenium platform specifications. Please contact the Biorepository & Tissue Analysis Shared Resource at Hollings, which can help with the sample slide preparation (oquinne@musc.edu).
  • Sample Quality: Users are responsible for ensuring samples meet Xenium quality requirements before submission (please see above for sample QC).

Visium CytAssist Spatial Gene Expression

Pricing | Sample Submission

The Visium CytAssist™ Spatial Gene Expression platform combines histology, tissue imaging, and spatially resolved transcriptomics to enable researchers to visualize whole-transcriptome gene expression within the native tissue architecture. The CytAssist workflow preserves spatial context while generating comprehensive molecular profiles, providing valuable insights into tissue organization, cellular interactions, and disease biology.

Key Features

  • We accept tissue sections mounted on standard glass slides, allowing investigators to leverage established histology workflows for tissue preparation, staining, imaging, and pathology review before spatial transcriptomic analysis.
  • This assay supports both H&E-stained and immunofluorescence-stained FFPE tissue sections provide flexibility for a wide range of translational research applications. Samples can be processed using either 6.5 × 6.5 mm or 11 × 11 mm Visium Capture Area formats based on study requirements.
  • AGP offers Visium HD Spatial Gene Expression capabilities, featuring capture areas composed of millions of 2 × 2 µm barcoded features arranged in a continuous high-density array. This next-generation technology enables near single-cell spatial resolution and supports data visualization and analysis across multiple bin sizes, providing unparalleled insight into tissue architecture and gene expression patterns.

Sample submission requirements

  • We only accept the slides after staining and imaging.
  • The sample must be located inside the green frame of the example slides, as in the figure below.
  • We highly recommend checking the sample RNA quality by RIN, DV200, and tissue quality by H&E (also DAPI) staining.
  • The samples with DV200>30% are recommended for the assay.

Please contact the Hollings Biorepository & Tissue Analysis Shared Resource, which can help with the sample slide preparation (oquinne@musc.edu). Please follow 10X guidelines (PDF).

Service Type Sample Type Chemistry Version Requirement DV200 
HD 6.5mm FFPE Probe-based RNA extraction (HS Tape) and H&E stain
>30%
HD 6.5mm Fresh/Fixed
Frozen
Probe-based RNA extraction (HS Tape) and H&E stain
>30%
HD 11mm FFPE Probe-based RNA extraction (HS Tape) and H&E stain
>30%
HD 11mm Fresh/Fixed
Frozen
Probe-based RNA extraction (HS Tape) and H&E stain
>30%
HD 6.5mm and 11mm Fresh
Frozen
3' poly A capture RNA extraction (HS Tape) and H&E stain
>30%

Bruker/Nanostring nCounter Pro

Pricing | Sample Submission

The nCounter Pro delivers direct, amplification-free digital quantification across more than 800 gene targets with unparalleled reproducibility, especially for FFPE and low-quality samples commonly seen in oncology, inflammation, and translational studies. Unlike PCR-based approaches, this eliminates enzymatic bias, ensuring highly stable results suitable for multi-center trials and precision-medicine workflows. The instrument’s multiomic capability allows simultaneous quantification of RNA and protein targets from the same sample, expanding research opportunities across cancer biology, immunology, neuroscience, and clinical trial–adjacent programs.

RNA applications include:

  • Targeted analysis of complex gene expression networks.
  • Characterization of gene fusions and splice variants.
  • miRNA expression analysis.
  • LncRNA expression analysis (custom order).

Protein applications are also available.

Data analysis

NanoString’s nSolver Analysis software is free to all users and can easily be downloaded to a PC or Mac.

Sample submission guidelines

Please provide cells or RNA. RNA QC must be provided; otherwise, AGP will QC the samples and charge the user accordingly.

  • Multiplex up to 800 targets in a single reaction (certain assays).
  • Minimal/no amplification or enzymatic reactions.
  • Utilize small sample quantities and can work with degraded RNA samples extracted from FFPE.
  • Diverse and difficult sample types: blood, tissue, and FFPE-derived samples, ChIP DNA.
  • High sensitivity and reproducibility.
  • Fast turnaround, sometimes as little as 4-5 working days.

Droplet Digital PCR (BioRad QX200)

Pricing | Sample Submission

Droplet Digital PCR (ddPCR) is a method for performing digital PCR where a sample is fractionated into 20,000 water-oil emulsion droplets, and PCR amplification of the template molecules occurs in each individual droplet. ddPCR technology uses reagents and workflows like those used for most standard TaqMan probe-based assays. The massive sample partitioning is a key aspect of the ddPCR technique.

Various ddPCR Applications

  • Gene expression and miRNA analyses.
  • Copy Number Variation (CNV).
  • Liquid biopsy.
  • Rare sequence/mutation detection.
  • NGS or single-cell library validation.
  • Pathogen detection.
  • Microbiome analysis.

Choose ddPCR for:

  • Absolute quantification.
  • Unparalleled precision.
  • Increased signal-to-noise ratio.
  • Removal of PCR bias.
  • Simplified quantification.
  • Reduced consumable costs.
  • Lower equipment costs.
  • Superior partitioning.

TapeStation

Pricing | Sample Submission

Provide 5 μL nucleic acid for the quantification. Please submit Nanodrop data for the nucleic acid TapeStation quantification. Any leftover samples can be picked up after data delivery.

Failure to submit the Nanodrop data will result in a $1/sample Nanodrop measurement.

shRNA Library Features

  • Largest and most validated shRNA collection.
  • Human library: 20,018 genes, 129,695 clones (1500-96 well plates).
  • Mouse library: 21,171 genes, 118,062 clones (1374-96 well plates).
  • Hairpins comprised of a 21mer base stem and a 6 base loop designed against NCBI REFSEQ.
  • Sequence, specificity, and position scoring with the Broad Institute algorithm.
  • A minimum of three to five shRNA constructs are created for each target gene to provide varying levels of knockdown and to target different regions of mRNA transcript.
  • For any given RefSeq, there is often a shRNA clone targeting the 3'UTR for use in phenotypic rescue studies using cDNA expression constructs.

Lentiviral Vector Features

  • shRNA cloned into the pLKO vector developed by the Broad Institute.
  • Allows for stable or transient transfection.
  • Self-inactivating replication incompetent viral particles can be produced in packaging cells (HEK293T) by co-transfection with compatible packaging plasmids.
  • Stable gene silencing is selected using the puromycin selectable marker.
  • Integrates for long-term knockdown.
  • Transduces virtually any cell type (dividing or non-dividing).
  • No interferon response.
  • Lack of recombination issues.

Mission Lentiviral Control Vectors

When conducting experiments using MISSION shRNA clones, proper controls are a key element of experimental design to permit accurate interpretation of knockdown results and provide assurance of the specificity of the response observed. The MISSION Control Vectors are lentiviral-based vectors that are useful as both positive and negative controls in experiments using the MISSION shRNA library. The DNA format controls may be used in direct transfection of target cells, or they may also be used to create replication-incompetent viral particles.

The control vectors listed below in the control selection table are held by Advanced Genomics Profiling. Further information on finding the appropriate controls for your experiments can be found at the Sigma Mission website. If you have questions, contact Mrinmoyee Majumder, Ph.D., at majumder@musc.edu.

Control Selection Table

Catalog Number
Description
Vector Backbone Insert Insert Sequence/Vector Description 
SHC001
MISSION
pLKO.1-puro
Empty Vector
Control
TRC1/1.5 No hairpin No shRNA Insert
SHC002
MISSION
pLKO.1-puro
Non-Mammalian
shRNA
Control 
TRC1/1.5 Non human or
mouse shRNA
CCGGCAACAAGATGAAGAGCACCAACTC-GAGTTGGTGCTCTTCATCTTGTTGTTTTT
SHC003
MISSION
pLKO.1-puroCMVTurboGFP™
Positive Contro
TRC1/1.5 No hairpin No shRNA insert. Contains TurboGFP gene,
under the control of the CMV promoter.
TurboGFP is an improved variant of the green
fluorescent protein copGFP cloned from the
copepoda Pontellina plumata.

Consultation

Projects that involve AGP services — especially scRNAseq, snRNAseq, Bulk RNAseq and ddPCR — begin with a free initial consultation to discuss experimental design, feasibility and timeline. Please consult Dr. Majumder (majumder@musc.edu) or Dr. Ouyang (ouyangj@musc.edu) at least four weeks prior to the intended sample submission.

To request this service, log in to Infinity and select AGP Consult Request.

Letter of Support

Dr. Ouyang can provide a letter of support (LOS) prior to submitting a grant proposal. You must make the request at least five business days prior to the submission deadline.

To request this service, log in to Infinity and select AGP Letter of Support.