Skip to main content

shRNA Services

Short hairpin RNAs (shRNAs) can efficiently suppress gene expression in human cells. The Translational Science Lab provides shRNA services, including access to genome-wide human and mouse libraries that together encode a total of almost 160,000 shRNA clones against over 41,000 genes.

We utilize The RNAi Consortium’s (TRC) genome-wide lentiviral mouse and human libraries, and investigators will have the option of ordering shRNAs targeting single or multiple genes, gene family sets, and pathway-specific pooled libraries.

The library will allow access to multiple shRNAs for a single gene, which is important for validation against off-target effects. This technology holds tremendous power and is ready to help investigators at MUSC work toward breakthrough discoveries.

For more information, contact Mrinmoyee Majumder, Ph.D., at majumder@musc.edu.

Schedule Use

shRNA Library Features

  • Largest and most validated shRNA collection.
  • Human library: 20,018 genes, 129,695 clones (1500-96 well plates).
  • Mouse library: 21,171 genes, 118,062 clones (1374-96 well plates).
  • Hairpins comprised of a 21mer base stem and a 6 base loop designed against NCBI REFSEQ.
  • Sequence, specificity, and position scoring with the Broad Institute algorithm.
  • A minimum of three to five shRNA constructs are created for each target gene to provide varying levels of knockdown and to target different regions of mRNA transcript.
  • For any given RefSeq, there is often a shRNA clone targeting the 3'UTR for use in phenotypic rescue studies using cDNA expression constructs.

Lentiviral Vector Features

  • shRNA cloned into the pLKO vector developed by the Broad Institute.
  • Allows for stable or transient transfection.
  • Self-inactivating replication incompetent viral particles can be produced in packaging cells (HEK293T) by co-transfection with compatible packaging plasmids.
  • Stable gene silencing is selected using the puromycin selectable marker.
  • Integrates for long-term knockdown.
  • Transduces virtually any cell type (dividing or non-dividing).
  • No interferon response.
  • Lack of recombination issues.

Mission Lentiviral Control Vectors

When conducting experiments using MISSION shRNA clones, proper controls are a key element of experimental design to permit accurate interpretation of knockdown results and provide assurance of the specificity of the response observed. The MISSION Control Vectors are lentiviral-based vectors that are useful as both positive and negative controls in experiments using the MISSION shRNA library. The DNA format controls may be used in direct transfection of target cells, or they may also be used to create replication-incompetent viral particles.

The control vectors listed below in the control selection table are held by the Translational Science Lab. Further information on finding the appropriate controls for your experiments can be found at the Sigma Mission website. If you have questions, contact Mrinmoyee Majumder, Ph.D., at majumder@musc.edu.

Control Selection Table

Catalog Number
Description
Vector Backbone Insert Insert Sequence/Vector Description 
SHC001
MISSION
pLKO.1-puro
Empty Vector
Control
TRC1/1.5 No hairpin No shRNA Insert
SHC002
MISSION
pLKO.1-puro
Non-Mammalian
shRNA
Control 
TRC1/1.5 Non human or
mouse shRNA
CCGGCAACAAGATGAAGAGCACCAACTC-GAGTTGGTGCTCTTCATCTTGTTGTTTTT
SHC003
MISSION
pLKO.1-puroCMVTurboGFPâ„¢
Positive Contro
TRC1/1.5 No hairpin No shRNA insert. Contains TurboGFP gene,
under the control of the CMV promoter.
TurboGFP is an improved variant of the green
fluorescent protein copGFP cloned from the
copepoda Pontellina plumata.

shRNA Order Request

Step 1: Finding shRNAs of Interest

Prior to ordering, the requestor will need to identify the TRCN number for the shRNA clones targeting their gene or genes of interest. Please follow these guidelines in order to identify the shRNA sequences you require:

  • Visit the Sigma Mission shRNA library website.
  • Select your favorite TM gene search.
  • Enter gene or gene symbol.
  • Check correct gene is chosen and from "products" select "shRNA."
  • From the search window that appears, select mouse or human Mission shRNA bacterial glycerol stock.
  • From the list that appears, select the shRNA sequences you require and make a note of the TRCN numbers for ordering.

Some of the shRNA sequences have already been validated by Sigma and are indicated. It is advised to identify where each sequence is located especially if isoforms exist for your target of interest. If we do not have the clones specified, we will try to provide alternative options.

We recommend sequencing all vectors to confirm the insert is correct as early as possible.

Step 2: Ordering shRNAs of Interest

All requests must be supported by a current investigator IBC# covering the target genes of interest and the use of lentiviral particles.

The Translational Science Lab uses Infinity to receive order requests and streamline the billing process. If you are already registered with Infinity, you can use your existing user information. If you don't have an existing account with Infinity, you can register as an internal user or register as an external user.

  • Complete the requested information. Infinity support staff will create your account.
  • Do not sign up if you’ve already received an Infinity welcome email.
  • You will receive an Infinity welcome email once your account has been created. This will contain your login and password.

Service Fees

Please find the service prices for obtaining shRNA glycerol stock listed below. Please contact Mrinmoyee Majumder, Ph.D., at majumder@musc.edu to discuss further pricing options.

Core Prices

Service/Item Price Format Note
Individual shRNA clones (glycerol) $40/clone Live culture stock 1-2ml – Antibiotic is ampicillin or carbenicillin